| Nome: | Descrição: | Tamanho: | Formato: | |
|---|---|---|---|---|
| 481.75 KB | Adobe PDF | |||
| 1.63 MB | Adobe PDF |
Autores
Orientador(es)
Resumo(s)
Resumo: A schistosomose é um problema de saúde pública e uma das Doenças Tropicais Negligenciadas mais importantes do mundo, atinge cerca de 240 milhões de pessoas e mais de 700 milhões vivem em áreas endémicas. É uma infeção parasitária, potencialmente crónica causada pelos platelmintas do género Schistosoma; a transmissão ao Homem ocorre através da água doce contaminada com as formas parasitárias (cercárias), que são libertadas pelo molusco, hospedeiro intermediário, infetado, e penetram no ser humano que entra em contacto com estes cursos de água. As espécies mais relevantes na África subsaariana são Schistosoma haematobium, que causa a schistosomose urogenital e Schistosoma mansoni, que causa a forma intestinal. Técnicas precisas de diagnóstico são importantes para uma determinação exata da prevalência da doença, para uma avaliação de programas de controlo e eliminação do parasita. De acordo com a OMS, o método de diagnóstico padrão é o exame parasitológico Kato-Katz (KK) para schistosomose intestinal e filtração da urina para a urogenital, no entanto, estes métodos não apresentam boa sensibilidade para áreas de baixa prevalência. Contudo, o teste imunocromatográfico POC-CCA deteta antigénios circulantes regurgitados por parasitas adultos e o seu formato como teste rápido apresenta algumas vantagens adicionais sobre as técnicas parasitológicas tradicionais, como a facilidade de uso e operação e o curto período de tempo necessário para o teste. No entanto, alguns problemas permanecem, incluindo a ocorrência de resultados falsos negativos, baixa sensibilidade e dificuldade de interpretação das leituras nomeadas como trace. Perante a necessidade de diagnóstico específico e sensível, a fim de detetar pequenas cargas parasitárias, esta tese tem como finalidade avaliar a sensibilidade do teste rápido POC-CCA na urina e fezes, tendo como referência a técnica de PCR, em amostras coletadas no distrito do Chókwè em Moçambique, área endémica para schistosomose. Foram incluídos 1033 indivíduos com uma idade média de 37,6 anos, sendo 28,3% do sexo masculino e 71,7% do sexo feminino. Foram coletadas 1033 amostras de urina para a avaliação de S. haematobium e 922 amostras de fezes para S. mansoni. A extração do DNA genómico foi realizada com o kit Speed Tools Tissue DNA. Para o PCR foi utilizado um par de primers específico para S. haematobium, ShF 5’AGTCGTGTCGATTTTAAGAC3’ e ShR
5’CCAACCATAAACATATGATG3’originando um fragmento de 365 pb, e um par de primers específico para S. mansoni, SmF 5’GAGATCAAGTGTGACAGTTTTGC3’ e SmR 5’ACAGTGCGCGCGTCGTAAGC3’ amplificando um fragmento de 350 pb. Os resultados para S. haematobium apresentaram uma maior prevalência no PCR, 10% (103/1033), e no método parasitológico e POC-CCA, apresentam respetivamente, 3,7% (38/1033) e 8,3% (86/1033). Não houve concordância entre POC-CCA e as demais técnicas (Kappa<0,3), entretanto houve concordância entre a técnica molecular e a parasitológica (Kappa>0,3). Para S. mansoni, apesar do Kato-Katz ter sido positivo para apenas duas amostras, para PCR a prevalência foi de 5,5% (51/922), enquanto para POC-CCA foi de 8,5% (78/922), contudo, a concordância entre os métodos manteve-se sem significado estatístico (Kappa<0). Em conclusão, o POC-CCA não parece ser um método eficaz para áreas de baixa endemicidade e para o controlo pós-terapêutico da schistosomose, sendo necessário investir no seu aperfeiçoamento e, se possível, uma combinação de métodos deva ser implementada em áreas endémicas.
Abstract: Schistosomiasis is a public health problem and one of the most important Neglected Tropical Diseases in the world, affecting about 240 million people and more than 700 million living in endemic areas. It is a potentially chronic parasitic infection caused by flatworms of the genus Schistosoma; transmission to humans occurs through fresh water contaminated with parasitic forms (cercariae), which are released by the freshwater snail, an intermediate infected host, and penetrate human beings who come into contact with these watercourses. The most relevant species in sub-Saharan Africa are Schistosoma haematobium, which causes urogenital schistosomiasis, and Schistosoma mansoni, which causes intestinal schistosomiasis. Precise diagnostic techniques are important for an accurate determination of disease prevalence, for an evaluation of a parasite control and elimination programs. According to WHO, the standard diagnostic method is the Kato-Katz (KK) for intestinal schistosomiasis and urine filtration for the urogenital form, however, these methods lack good sensitivity for low prevalence areas. However, the POC-CCA immunochromatographic test detects circulating antigens regurgitated by adult parasites and its format as a rapid test has some additional advantages over traditional parasitological techniques, such as easier to use and operation and the short time required for the test. However, some problems remain, including the occurrence of false negative results, low sensitivity and difficulty in interpreting readings named as trace. Given the need for specific and sensitive diagnosis, in order to detect small parasitic loads, this thesis aims to assess the sensitivity of the rapid POC-CCA test in urine and stool, using the PCR technique as a reference, in samples collected in the district of Chókwè in Mozambique, an endemic area for schistosomiasis. A total of 1033 individuals were included with a mean age of 37.6 years, 28.3% male and 71.7% female. 1033 urine samples were collected for the evaluation of S. haematobium and 922 stool samples for S. mansoni. Genomic DNA extraction was performed with the Speed Tools Tissue DNA kit. For the PCR, specific primers for S. haematobium, ShF 5'AGTCGTGTCGATTTTAAGAC3' and ShR 5'CCAACCATAAACATATGATG3' and for S. mansoni, SmF 5'GAGATCAAGTGTGACAGTTTTGC3' and SmR 5'ACAGTGCGCGCGTCGTAAGC3' were used, originating 365 bp and 350 bp amplicons respectively. The results for S. haematobium showed a higher prevalence in PCR, 10% (103/1033), and in the parasitological method and POC-CCA, they presented, respectively, 3.7% (38/1033) and 8.3% (86/1033). The observed agreement between POC-CCA and the other techniques was not significant (Kappa<0,3), however it was observed agreement between the molecular and parasitological technique (Kappa>0.3). Although, the Kato-Katz technique was positive only for two samples, the prevalence with PCR technique was 5.5% (51/922), while for POC- CCA it was 8.5% (78/922). However, the agreement between these methods remained insignificant (Kappa<0,3). In conclusion, the POC-CCA seems to be an inefficient method for areas of low endemicity and for the post-therapeutic control of schistosomiasis, therefore it is necessary to invest in its improvement and, if possible, a combination of methods should be implemented in endemic areas.
Abstract: Schistosomiasis is a public health problem and one of the most important Neglected Tropical Diseases in the world, affecting about 240 million people and more than 700 million living in endemic areas. It is a potentially chronic parasitic infection caused by flatworms of the genus Schistosoma; transmission to humans occurs through fresh water contaminated with parasitic forms (cercariae), which are released by the freshwater snail, an intermediate infected host, and penetrate human beings who come into contact with these watercourses. The most relevant species in sub-Saharan Africa are Schistosoma haematobium, which causes urogenital schistosomiasis, and Schistosoma mansoni, which causes intestinal schistosomiasis. Precise diagnostic techniques are important for an accurate determination of disease prevalence, for an evaluation of a parasite control and elimination programs. According to WHO, the standard diagnostic method is the Kato-Katz (KK) for intestinal schistosomiasis and urine filtration for the urogenital form, however, these methods lack good sensitivity for low prevalence areas. However, the POC-CCA immunochromatographic test detects circulating antigens regurgitated by adult parasites and its format as a rapid test has some additional advantages over traditional parasitological techniques, such as easier to use and operation and the short time required for the test. However, some problems remain, including the occurrence of false negative results, low sensitivity and difficulty in interpreting readings named as trace. Given the need for specific and sensitive diagnosis, in order to detect small parasitic loads, this thesis aims to assess the sensitivity of the rapid POC-CCA test in urine and stool, using the PCR technique as a reference, in samples collected in the district of Chókwè in Mozambique, an endemic area for schistosomiasis. A total of 1033 individuals were included with a mean age of 37.6 years, 28.3% male and 71.7% female. 1033 urine samples were collected for the evaluation of S. haematobium and 922 stool samples for S. mansoni. Genomic DNA extraction was performed with the Speed Tools Tissue DNA kit. For the PCR, specific primers for S. haematobium, ShF 5'AGTCGTGTCGATTTTAAGAC3' and ShR 5'CCAACCATAAACATATGATG3' and for S. mansoni, SmF 5'GAGATCAAGTGTGACAGTTTTGC3' and SmR 5'ACAGTGCGCGCGTCGTAAGC3' were used, originating 365 bp and 350 bp amplicons respectively. The results for S. haematobium showed a higher prevalence in PCR, 10% (103/1033), and in the parasitological method and POC-CCA, they presented, respectively, 3.7% (38/1033) and 8.3% (86/1033). The observed agreement between POC-CCA and the other techniques was not significant (Kappa<0,3), however it was observed agreement between the molecular and parasitological technique (Kappa>0.3). Although, the Kato-Katz technique was positive only for two samples, the prevalence with PCR technique was 5.5% (51/922), while for POC- CCA it was 8.5% (78/922). However, the agreement between these methods remained insignificant (Kappa<0,3). In conclusion, the POC-CCA seems to be an inefficient method for areas of low endemicity and for the post-therapeutic control of schistosomiasis, therefore it is necessary to invest in its improvement and, if possible, a combination of methods should be implemented in endemic areas.
Descrição
Palavras-chave
Ciências biomédicas Biologia molecular Schistosoma haematobium Schistosoma mansoni POC-CCA PCR Chókwè Moçambique
